| Transcript_134 | ||
cmscan-Rfam |
||
Family :Histone3 |
Id:RF00032 |
Type:Cis-reg; |
Taxonomy:Eukaryota; Bacteria; Viruses; Archaea; | Ontology:GO:0006398 histone mRNA 3'-end processing |
|
Description:The mRNAs of metazoan histone genes lack a poly-A tail. 3' end processing occurs at asite between a highly conserved stem-loop (modelled by this family) and a purine rich region around 20 nts downstream (the histone downstream element, or HDE). The stem-loop is bound by a 31 kDa stem-loop binding protein (SLBP - also termed the histone hairpin binding protein, or HBP). Together with U7 snRNA binding of the HDE, SLBP binding nucleate s the formation of the processing complex. The histone 3' UTR stem-loop is also involved in nucleocytoplasmic transport of the mRNA, and in stability regulation and translation efficiency in the cytoplasm. | ||
Score:32.5 |
E-value:1.8e-07 |
|
From sequence:660 |
To sequence:704 |
|
Alignments: NC | ||
RNAfold |
||
| >Transcript_134 CCAAAGGCUCUUAUAAGAGCCACCACGGCUUCAUUAAAAGUGCAAA ......((.(((.((((((((.....)))))..))).))).))... (-11.10) |
![]() |
|
Length sequence: 46 |
Length match:43 |
|